Tank Dry Top Mujer Elastika Nike Avx8p8w

Publique en esta revista
Tank Nike Mujer Elastika Top Dry
Introduzca su usuario y contraseña
* *
* = Campos obligatorios
Introduzca su e-mail
Tank Dry Top Mujer Elastika Nike Avx8p8w Tank Dry Top Mujer Elastika Nike Avx8p8w
Información de la revista
Nike Tank Elastika Top Dry Mujer
Vol. 49. Núm. 12. Diciembre 2013
Páginas 501-556
  • Resumen
  • Palabras clave
  • Abstract
  • Keywords
  • Introducción
    • Resumen
    • Palabras clave
    • Abstract
    • Keywords
    • Introducción
    • Observación clínica
    • Caso 1
    • Caso 2
    • Discusión
    • Conflicto de intereses
Mujer Top Dry Tank Elastika Nike Visitas
Vol. 49. Núm. 12. Diciembre 2013
Páginas 501-556
Nota clínica
DOI: 10.1016/j.arbres.2013.05.004
Déficit de alfa-1-antitripsina asociado a la variante Matawa
Alpha-1-Antitrypsin Deficiency Associated With the Mattawa Variant
Beatriz Lara a,
Dry Top Elastika Mujer Tank Nike Autor para correspondencia
Tank Dry Elastika Top Nike Mujer
, Beatriz Martínez-Delgado b , Maria Luisa Torres Rojas Tacón De Oficinas Even Para amp;odd Sandalias Mujer Aguja 74B4O , Sandra Marín-Arguedas d , Ana Bustamante e , Marc Miravitlles f
a Servicio de Neumología, Hospital Universitario Arnau de Vilanova, Lleida, España
b Unidad de Genética Molecular, Área de Genética Humana, Instituto de Investigación en Enfermedades Raras, Instituto de Salud Carlos III, Madrid, España
c Dry Top Tank Mujer Nike Elastika Servicio de Neumología, Complexo Hospitalario Universitario de Vigo, Vigo, Pontevedra, España
d Servicio de Neumología, Hospital Dos de Maig, Barcelona, España
e Servicio de Neumología, Hospital de Sierrallana, Torrelavega, Cantabria, España
f Servicio de Neumología, Hospital Universitario Vall d’Hebron, Barcelona, España
Este artículo ha recibido
Mono Azul Sudadera Adidas Chicos Crewneck 4nOpYx6qw
Información del artículo
Texto Completo
Descargar PDF
Figuras (1)

Los alelos deficitarios más frecuentes son los Pi*S y Pi*Z, pero existen también otras variantes deficientes.

En la presente nota clínica se describen los 2 primeros casos detectados en España de déficit de alfa-1-antitripsina (DAAT), resultante de la combinación de un alelo nulo Mattawa con un normal PI*M y con un raro Mmalton.

Ambos casos fueron inicialmente diagnosticados como Pi*MM por isoelectroenfoque (IEE), pero los valores séricos bajos de AAT hicieron sospechar la existencia de alelos deficientes infrecuentes indetectables por IEE, por lo que se realizó un análisis molecular del gen que proporcionó el diagnóstico correcto.

Las incoherencias entre los valores séricos de AAT y el fenotipo deben hacer sospechar la existencia de uno de estos alelos infrecuentes.

Elastika Dry Top Mujer Tank Nike Palabras clave:
Déficit de alfa-1-antitripsina
Registro Español de pacientes con déficit de alfa-1-antitripsina

The most common deficiency alleles for alpha-1-antitrypsin deficiency (AATD) are Pi*S and Pi*S, but there are also other deficiency variants.

This case report describes the first two cases of AATD detected in Spain resulting from the combination of a null Mattawa allele with a normal PI*M, and a rare Mmalton.

Both cases were initially diagnosed as Pi*MM by isoelectric focusing (IEF), but the low serum AAT values led us to suspect the existence of rare deficiency alleles that were undetectable using this technique, and to performing molecular analysis of the gene, which provided the correct diagnosis.

Inconsistencies between serum AAT values and the phenotype should make one suspect the existence of one of these rare alleles.

Alpha-1-antitrypsin deficiency
Spanish Registry of patients with alpha-1-antitrypsin deficiency
Texto Completo

Los alelos normales de alfa-1-antitripsina (AAT), presentes en el 85-90% de los individuos, se denominan M, y los deficientes más frecuentes, S y Z (frecuencias respectivas: 10 y 1,7% de la población española)1. Los alelos M, S y Z expresan respectivamente alrededor del 100, del 40 y del 15% de AAT sérica2.

El déficit grave de AAT, definido por niveles séricos por debajo del 35% del valor medio esperado, es una condición rara, generalmente asociada a homocigotos PI*ZZ y con mucha menor frecuencia a combinaciones de alelos Z, S, raros y nulos. Sin embargo, en los últimos años el laboratorio del Registro Español de Pacientes con Déficit de AAT (REDAAT) ha detectado un 1,6% de alelos raros y nulos3 (tasa comparable a la encontrada en Italia, Suiza, Alemania y Estados Unidos)4,5, la mayoría Mmalton, pero también Mheerlen, NullClayton, NullBellingham, Mvhebron, YbarcelonaPara Cartera Hombre Unisex Adulto Única Talla Sunop 57vRqwUCC, etc.

Observación clínicaCaso 1

Mujer de 47años no fumadora, con hipertensión arterial esencial, bronquitis de repetición desde los 25años y disnea de esfuerzo en los 3 últimos años.

Su espirometría fue normal (FVC 96%, FEV1 105%, FEV1/FVC 84), pero su capacidad de difusión, DLCO y KCO, fueron del 68 y del 61% de sus valores teóricos respectivos. La TAC torácica presentó acentuación del patrón bronquial sin signos de bronquiectasias ni de enfisema. La función hepática fue normal. La concentración de AAT en suero fue de 73,7mg/dl (referencia: 103-200), compatible con un déficit parcial de AAT, y el fenotipo etiquetado como Pi MM, no concordante con las concentraciones de AAT, por lo que se realizó una secuenciación del gen de la AAT en sangre periférica que detectó una mutación PI Null Mattawa, caracterizada por la inserción de un nucleótido dentro de la región codificadora del exón5, que desplaza el marco de lectura (frameshift mutation) a la posición 376, lo que genera una señal de stop prematura, que finalmente traduce una proteína truncada, muy inestable, que se degrada dentro del hepatocito y resulta indetectable en suero9 (Escolar Fedso Eurtay658005n Escolar Mochila Fedso Eurtay658005n Mochila 0Hvv6w).

Figura 1.

Secuencia correspondiente al exón 5 del gen SERPINA1. A)Secuencia normal. B)Elastika Top Dry Mujer Tank Nike Secuencia correspondiente a la paciente, donde se ve la inserción de una timina (T) en vez de una adenina (A) en el codón 376 del exón 5 en heterocigosis, correspondiente al alelo PI-Mattawa. La secuencia codificante del gen SERPINA1 (exones 2 a 5) se analizó utilizando primers previamente descritos para los exones 3 a 5 y primers ex2F 5′ACGTGGTGTCAATCCCTGATCACTG3′ y ex2R 5′TATGGGAACAGCTGG3′ para el exón 2, tomando como referencia comparativa la SERPINA1_Transcript_ENST00000440909.

La paciente tenía además otra variante normal en el exón5, consistente en un cambio de adenina (A) por citosina (C) en el nucleótido 1200 del cDNA, que genera un cambio de aminoácido glutámico (Glu) por aspártico (Asp) en el codón400 (c.1200A>C/p.Glu400Asp), que se correspondía con un alelo M3. Por tanto, se trata de un genotipo heterocigoto PI*M3-Null Mattawa, con niveles séricos de AAT moderadamente reducidos.

Caso 2

A partir de la base de datos del REDAATTop Mujer Tank Elastika Nike Dry Mujer Tank Elastika Dry Nike Top 10 se localizó otra persona portadora del alelo Null Matawa.

Mujer de 67años con antecedentes de tuberculosis pleuropulmonar con curación bacteriológica documentada. Frecuentes episodios de infecciones respiratorias. Parámetros funcionales compatibles con una obstrucción al flujo aéreo grave (FEV1: 620ml [22% del valor teórico], FVC: 1.280ml [39% del valor teórico]). Un TAC de alta resolución mostró enfisema centrolobulillar y paraseptal difuso y bronquiectasias cilíndricas difusas. Nunca se detectaron datos de afectación hepática.

Sus concentraciones de AAT en suero eran de 43mg/dl. El IEE sugirió un fenotipo Pi MM, pero al no corresponderse con la concentración sérica de AAT se realizó un estudio genético, que detectó un alelo PI*Mmalton (deleción del residuo 52)11 y un PI*Null Mattawa, cuya combinación justificó las bajas concentraciones séricas de AAT de la paciente.


La excepcionalidad de los alelos nulos (prevalencia estimada 100-200 veces inferior que los Z) impide el conocimiento preciso de su impacto clínico y de su verdadera prevalencia. Sin embargo, es importante tenerlos en cuenta, ya que pueden generar confusiones diagnósticas si no se realizan estudios genómicos.

El alelo Mmalton (también denominado Mcagliari y Mnichinan) fue descrito por primera vez en 1987 y, al igual que el gen Z, produce una proteína mal plegada, de la que un 80-90% polimeriza en el hepatocito sin ser secretada a sangre, donde expresa niveles inferiores al 15%, y se asocia con alto riesgo de enfisema pulmonar y de hepatopatía11,12,.

El alelo Mattawa (y en general cualquier alelo nulo) se caracteriza por codificar proteínas con importantes cambios conformacionales, que son degradadas a nivel intracelular sin llegar a polimerizar, y expresan concentraciones indetectables de AAT sérica. Esto hace que los homocigotos conlleven un riesgo muy alto de enfisema, pero no de hepatopatía.

En conclusión, en nuestras pacientes la discordancia entre el fenotipo y las concentraciones séricas de AAT hizo sospechar la existencia de alelos infrecuente, y fue finalmente el análisis molecular del gen el que proporcionó el diagnóstico correcto, tal como se recoge en las recomendaciones2.

Conflicto de intereses

Los autores declaran no tener ningún conflicto de intereses.


Los autores agradecen al Dr. Ignacio Blanco su importante contribución a la redacción de este artículo.

I. Blanco,E. Fernández-Bustillo,F.J. de Serres,D. Alkassam,C. Rodríguez
P.I.*S and PI*Z alpha-1 antitrypsin deficiency: Estimated prevalence and number of deficient subjects in Spain
Med Clin (Barc), 123 (2004), pp. 761-765
R. Vidal,I. Blanco,F. Casas,R. Jardí,M. Miravitlles
Normativa sobre diagnóstico y tratamiento del déficit de alfa-1 antitripsina
Arch Bronconeumol, 42 (2006), pp. 645-659
F. Rodríguez-Frías,M. Miravitlles,R. Vidal,S. Campos,R. Jardi
Rare alpha-1 antitrypsin variants: Are they really so rare?
Ther Adv Respir Dis, 6 (2012), pp. 79-85 http://dx.doi.org/10.1177/1753465811434320
M. Zorzetto,E. Russi,O. Senn,M. Imboden,I. Ferrarotti,C. Tinelli
SERPINA1 gen variants in individuals from general population with reduced alpha-1-antitrypsin concentrations
Clin Chem, 54 (2008), pp. 1331-1338 http://dx.doi.org/10.1373/clinchem.2007.102798
J.A. Bornhorst,D.N. Greene,E.R. Ashwood,D.G. Grenache
Alpha 1-antitrypsin phenotypes and associated serum protein concentrations in a large clinical population
Chest, 143 (2013), pp. 1000-1008 http://dx.doi.org/10.1378/chest.12-0564
De Negro Cuplé Botines Mujer Serraje gyR8Hqa
R. Jardí,F. Rodríguez-Frías,J.C. López-Talavera,M. Miravitlles,M. Cotrina,X. Costa
Characterization of the new alpha-1-antitrypsin-deficient PI M-type allele, PI M(vall d’hebron) (Pro(369)→Ser)
Hum Hered, 50 (2000), pp. 320-321 http://dx.doi.org/22935
M. Miravitlles,S. Vilà,R. Jardí,C. de la Roza,F. Rodríguez-Frías,R. Vidal
Emphysema due to alpha-antitrypsin deficiency: Familial study of the YBARCELONA variant
Chest, 124 (2003), pp. 404-406
D. Curiel,M. Brantly,E. Curiel,L. Stier,R.G. Crystal
Alpha-1-antitrypsin deficiency caused by the alpha-1-antitrypsin null(Mattawa) gene: An insertion mutation rendering the alpha-1-antitrypsin gene incapable of producing alpha-1-antitrypsin
J Clin Invest, 83 (1989), pp. 1144-1152 http://dx.doi.org/10.1172/JCI113994
Vaqueros Pinko Pantalones Vaqueros Pinko Mujer Pantalones qTI8x
D.W. Cox,H. Levison
Emphysema of early onset associated with a complete deficiency of alpha-1-antitrypsin (null homozygotes)
Am Rev Respir Dis, 137 (1988), pp. 371-375 http://dx.doi.org/10.1164/ajrccm/137.2.371
Mujer The The Sudadera Sport The Sport Sudadera Mujer Kooples Kooples Kooples Sport wTTPO01qx
B. Lara,C. de la Roza,S. Vilà,R. Vidal,M. Miravitlles
Development and results of the Spanish Registry of patients with alpha-1-antitrypsin deficiency
Int J COPD, 2 (2007), pp. 1-6
G.C. Fraizer,T.R. Harrold,M.H. Hofker,D.W. Cox
In-frame single codon deletion in the M(Malton) deficiency allele of alpha-1-antitrypsin
Am J Hum Genet, 44 (1989), pp. 894-902
A. Graham,N.A. Kalsheker,C.R. Newton,F.J. Bamforth,S.J. Powell,A.F. Markham
Molecular characterisation of three alpha-1-antitrypsin deficiency variants: Proteinase inhibitor (Pi) Null (Cardiff) (asp256-to-val), Pi M(Malton) (phe51-deletion) and Pi I (arg39-to-cys)
Hum Genet, 84 (1989), pp. 55-58
Copyright © 2013. SEPAR

Suscríbase al Newsletter

Resumen gráfico
La revista pertenece al Committee on Publication Ethics (COPE) www.publicationethics.org y se adhiere a sus principios y procedimientos.
Archivos de Bronconeumología

Suscríbase al Newsletter

Opciones de artículo
es en
Política de cookies Cookies policy
Utilizamos cookies propias y de terceros para mejorar nuestros servicios y mostrarle publicidad relacionada con sus preferencias mediante el análisis de sus hábitos de navegación. Si continua navegando, consideramos que acepta su uso. Puede cambiar la configuración u obtener más información aquí. To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here.
es en

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?